Transcript: Human NM_080826.2

Homo sapiens isthmin 1 (ISM1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ISM1 (140862)
Length:
3090
CDS:
504..1898

Additional Resources:

NCBI RefSeq record:
NM_080826.2
NBCI Gene record:
ISM1 (140862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254075 TCATAGCTGCGGTCGTGTATA pLKO_005 1984 3UTR 100% 13.200 18.480 N ISM1 n/a
2 TRCN0000254074 CAAGAGGCCAGGGAATATTAA pLKO_005 1878 CDS 100% 15.000 10.500 N ISM1 n/a
3 TRCN0000254071 GGTGACTGGAGCAGGTATAAC pLKO_005 1785 CDS 100% 13.200 9.240 N ISM1 n/a
4 TRCN0000254073 TTGCGGGAAGCGAGGAGTTTA pLKO_005 1336 CDS 100% 13.200 9.240 N ISM1 n/a
5 TRCN0000254072 ACCAAACTTTCCAGATCTTTC pLKO_005 824 CDS 100% 10.800 7.560 N ISM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.