Transcript: Human NM_138367.2

Homo sapiens zinc finger protein 251 (ZNF251), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF251 (90987)
Length:
2953
CDS:
203..2218

Additional Resources:

NCBI RefSeq record:
NM_138367.2
NBCI Gene record:
ZNF251 (90987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230780 ATAGTTCAGATGACTACTAAA pLKO_005 2327 3UTR 100% 13.200 9.240 N ZNF251 n/a
2 TRCN0000230778 GTCGAAGCTCAACTCTTATTC pLKO_005 1110 CDS 100% 13.200 9.240 N ZNF251 n/a
3 TRCN0000218436 GTTTGAACAAACCCAATATTC pLKO_005 663 CDS 100% 13.200 9.240 N ZNF251 n/a
4 TRCN0000230777 TTGTATCAAGAAGACTCTTAA pLKO_005 555 CDS 100% 13.200 9.240 N ZNF251 n/a
5 TRCN0000230779 CCTCCATCATCGGGTTCATAC pLKO_005 1381 CDS 100% 10.800 7.560 N ZNF251 n/a
6 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 1149 CDS 100% 13.200 6.600 Y Zfp992 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.