Transcript: Mouse NM_145456.3

Mus musculus zinc finger SWIM-type containing 6 (Zswim6), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Zswim6 (67263)
Length:
5457
CDS:
16..3639

Additional Resources:

NCBI RefSeq record:
NM_145456.3
NBCI Gene record:
Zswim6 (67263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252545 CAATTGGCGACGTCGAGAAAT pLKO_005 2721 CDS 100% 13.200 18.480 N Zswim6 n/a
2 TRCN0000258245 CAACGGTACTGTCGGACATTT pLKO_005 3293 CDS 100% 13.200 10.560 N Zswim6 n/a
3 TRCN0000236690 ATTGCGTTTGCAGACTAAATT pLKO_005 3764 3UTR 100% 15.000 10.500 N ZSWIM6 n/a
4 TRCN0000252543 ATTGCGTTTGCAGACTAAATT pLKO_005 3764 3UTR 100% 15.000 10.500 N Zswim6 n/a
5 TRCN0000252544 GAATGAGCTAGCAGCTATAAT pLKO_005 3243 CDS 100% 15.000 10.500 N Zswim6 n/a
6 TRCN0000252546 CTCGGCACTATAGCGAGTTTA pLKO_005 3476 CDS 100% 13.200 9.240 N Zswim6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.