Transcript: Human NM_153366.4

Homo sapiens sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 (SVEP1), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SVEP1 (79987)
Length:
12205
CDS:
199..10914

Additional Resources:

NCBI RefSeq record:
NM_153366.4
NBCI Gene record:
SVEP1 (79987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243464 ACGTAGATGGATCCTACATAT pLKO_005 5486 CDS 100% 13.200 18.480 N SVEP1 n/a
2 TRCN0000243463 ATCGATTCTAAGAGCATATTT pLKO_005 5059 CDS 100% 15.000 10.500 N SVEP1 n/a
3 TRCN0000243462 GCCAAGTCCTCACGGATTAAA pLKO_005 2890 CDS 100% 15.000 10.500 N SVEP1 n/a
4 TRCN0000243465 GCGTCTGGAAACCAACATATA pLKO_005 2519 CDS 100% 13.200 9.240 N SVEP1 n/a
5 TRCN0000243466 TTAGGGTAGCCTGGCTAATTC pLKO_005 11517 3UTR 100% 13.200 9.240 N SVEP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.