Transcript: Human NM_153605.4

Homo sapiens crystallin beta-gamma domain containing 3 (CRYBG3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CRYBG3 (131544)
Length:
10779
CDS:
197..9109

Additional Resources:

NCBI RefSeq record:
NM_153605.4
NBCI Gene record:
CRYBG3 (131544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153605.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253812 GGCTTGCCTACCCAGATATTA pLKO_005 7488 CDS 100% 15.000 21.000 N CRYBG3 n/a
2 TRCN0000253811 TTCCGGTACTTACAAGCTAAT pLKO_005 7880 CDS 100% 10.800 15.120 N CRYBG3 n/a
3 TRCN0000265431 CTGGAACCACTTGGGATAAAT pLKO_005 8165 CDS 100% 15.000 12.000 N CRYBG3 n/a
4 TRCN0000265429 GTCAGTGTCAGAACGTTTAAA pLKO_005 6580 CDS 100% 15.000 12.000 N CRYBG3 n/a
5 TRCN0000253810 GAATCTTCTGTCACACTATTT pLKO_005 7907 CDS 100% 13.200 10.560 N CRYBG3 n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 6639 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153605.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.