Transcript: Mouse NM_172672.2

Mus musculus glucosidase, alpha; neutral C (Ganc), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ganc (76051)
Length:
4818
CDS:
1136..3877

Additional Resources:

NCBI RefSeq record:
NM_172672.2
NBCI Gene record:
Ganc (76051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265586 CATGCTGGGAAGCGCTTTATT pLKO_005 3277 CDS 100% 15.000 10.500 N Ganc n/a
2 TRCN0000254539 TAGACTAGCTTAAGCTATATT pLKO_005 4101 3UTR 100% 15.000 10.500 N Ganc n/a
3 TRCN0000254536 AGGCCTCTGTGGGTCGAATAT pLKO_005 3218 CDS 100% 13.200 9.240 N Ganc n/a
4 TRCN0000254538 TGCAGAGTCACATCAACTTAA pLKO_005 1825 CDS 100% 13.200 9.240 N Ganc n/a
5 TRCN0000254537 TGGAGATGCATACCGTCTTTA pLKO_005 1858 CDS 100% 13.200 9.240 N Ganc n/a
6 TRCN0000429210 CAAGGTCAGAGAGTGGTATTC pLKO_005 2584 CDS 100% 10.800 7.560 N GANC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.