Transcript: Mouse NM_173861.2

Mus musculus casein kinase 2, alpha prime interacting protein (Csnka2ip), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Csnka2ip (224291)
Length:
1325
CDS:
468..1298

Additional Resources:

NCBI RefSeq record:
NM_173861.2
NBCI Gene record:
Csnka2ip (224291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262758 CCCTGCATCCGAATCTGATTT pLKO_005 791 CDS 100% 13.200 18.480 N Csnka2ip n/a
2 TRCN0000262756 AGAGTGTGCTTCCGCCATAAA pLKO_005 530 CDS 100% 13.200 9.240 N Csnka2ip n/a
3 TRCN0000262759 ATCCTCCGAGAGCAAAGATTT pLKO_005 851 CDS 100% 13.200 9.240 N Csnka2ip n/a
4 TRCN0000262760 CCCGCCTTTCATCAACATATT pLKO_005 499 CDS 100% 13.200 9.240 N Csnka2ip n/a
5 TRCN0000262757 GATGACAATCTGGACGTATTA pLKO_005 750 CDS 100% 13.200 7.920 N Csnka2ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.