Transcript: Mouse NM_175432.3

Mus musculus transmembrane protein 132C (Tmem132c), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem132c (208213)
Length:
5113
CDS:
90..3413

Additional Resources:

NCBI RefSeq record:
NM_175432.3
NBCI Gene record:
Tmem132c (208213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251011 ACAAATGACTGTCGGTTTATA pLKO_005 3802 3UTR 100% 15.000 21.000 N Tmem132c n/a
2 TRCN0000251013 CGAAATAGGAGCAGCAATTTA pLKO_005 1221 CDS 100% 15.000 21.000 N Tmem132c n/a
3 TRCN0000251010 ATGAGCACACGACCATCATAG pLKO_005 3067 CDS 100% 10.800 15.120 N Tmem132c n/a
4 TRCN0000258144 TAGGCCCAACCAGTAAGTTTC pLKO_005 466 CDS 100% 10.800 15.120 N Tmem132c n/a
5 TRCN0000251012 ATCTGTCACCATCGCCAATAA pLKO_005 1034 CDS 100% 13.200 10.560 N Tmem132c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.