Transcript: Mouse NM_176976.4

Mus musculus centrosomal protein 295 (Cep295), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Cep295 (319675)
Length:
7380
CDS:
46..7188

Additional Resources:

NCBI RefSeq record:
NM_176976.4
NBCI Gene record:
Cep295 (319675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264969 CTAAACCTCCTAGGGTAATAA pLKO_005 2372 CDS 100% 15.000 21.000 N Cep295 n/a
2 TRCN0000264968 GACTATGAGTTCGTCCTTAAA pLKO_005 2281 CDS 100% 13.200 10.560 N Cep295 n/a
3 TRCN0000264966 GGATACTGGCTATGGTATAAT pLKO_005 6810 CDS 100% 15.000 10.500 N Cep295 n/a
4 TRCN0000264965 CATTAGAGCAGAGTCATATTC pLKO_005 2132 CDS 100% 13.200 9.240 N Cep295 n/a
5 TRCN0000264967 GGTGAAACAGCAAAGAGAATG pLKO_005 7193 3UTR 100% 10.800 7.560 N Cep295 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.