Transcript: Mouse NM_183155.3

Mus musculus nrde-2 necessary for RNA interference, domain containing (Nrde2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Nrde2 (217827)
Length:
3710
CDS:
51..3554

Additional Resources:

NCBI RefSeq record:
NM_183155.3
NBCI Gene record:
Nrde2 (217827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328285 GCCGAGCGGTCCACATATTAA pLKO_005 2590 CDS 100% 15.000 21.000 N Nrde2 n/a
2 TRCN0000328215 CCTGCCAACTGGGAGTATAAA pLKO_005 570 CDS 100% 15.000 12.000 N Nrde2 n/a
3 TRCN0000328288 ATTTGGAGCCTTGGCTATTTG pLKO_005 3148 CDS 100% 13.200 10.560 N Nrde2 n/a
4 TRCN0000328217 CGAGATTGCAAAGGTCATTTG pLKO_005 2279 CDS 100% 10.800 8.640 N Nrde2 n/a
5 TRCN0000328214 GTGAAAGAGCTGCCTACTAAA pLKO_005 1581 CDS 100% 13.200 9.240 N Nrde2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.