Transcript: Mouse NM_207221.2

Mus musculus jumonji domain containing 1C (Jmjd1c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Jmjd1c (108829)
Length:
8382
CDS:
1..7593

Additional Resources:

NCBI RefSeq record:
NM_207221.2
NBCI Gene record:
Jmjd1c (108829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231334 TGGTGCTCTATGGCATATTTA pLKO_005 7131 CDS 100% 15.000 21.000 N Jmjd1c n/a
2 TRCN0000231331 CTGGCGGTCTACGTGGAATTT pLKO_005 160 CDS 100% 13.200 18.480 N Jmjd1c n/a
3 TRCN0000231335 TGATTCAATGCTAGCTATAAA pLKO_005 7735 3UTR 100% 15.000 10.500 N Jmjd1c n/a
4 TRCN0000231333 AGTAACTACTTCACTACTTTA pLKO_005 3253 CDS 100% 13.200 9.240 N Jmjd1c n/a
5 TRCN0000231332 ATGACCTTGAGTGGGATAAAC pLKO_005 182 CDS 100% 13.200 9.240 N Jmjd1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.