Transcript: Mouse NR_015491.1

Mus musculus RIKEN cDNA A630089N07 gene (A630089N07Rik), long non-coding RNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
A630089N07Rik (320586)
Length:
2131
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_015491.1
NBCI Gene record:
A630089N07Rik (320586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_015491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240105 CCGAAGGATGAATTGACCTAT pLKO_005 89 3UTR 100% 4.950 6.930 N A630089N07Rik n/a
2 TRCN0000240103 ACCCTATGAAGTGATGTATTA pLKO_005 394 3UTR 100% 13.200 10.560 N A630089N07Rik n/a
3 TRCN0000240104 ATGCGAGCATCAGCAACAAAT pLKO_005 1130 3UTR 100% 13.200 9.240 N A630089N07Rik n/a
4 TRCN0000240107 AGGTGAGAGTGCAGACTATAG pLKO_005 488 3UTR 100% 10.800 7.560 N A630089N07Rik n/a
5 TRCN0000240106 CCAGCCCTTCAAGGATAATAA pLKO_005 1729 3UTR 100% 15.000 9.000 N A630089N07Rik n/a
6 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 385 3UTR 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_015491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.