Transcript: Human NR_027135.1

Homo sapiens zinc finger and SCAN domain containing 18 (ZSCAN18), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZSCAN18 (65982)
Length:
1778
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027135.1
NBCI Gene record:
ZSCAN18 (65982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1448 3UTR 100% 13.200 6.600 Y LOC676710 n/a
2 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1448 3UTR 100% 10.800 5.400 Y Zfp647 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.