Transcript: Human NR_028032.1

Homo sapiens HLA complex group 9 (HCG9), long non-coding RNA.

Source:
NCBI, updated 2018-05-18
Taxon:
Homo sapiens (human)
Gene:
HCG9 (10255)
Length:
670
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028032.1
NBCI Gene record:
HCG9 (10255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250130 GCCAGGGTGCATCTCAATAAA pLKO_005 453 3UTR 100% 15.000 10.500 N HCG9 n/a
2 TRCN0000250127 CATCTCAATAAACTTGGATTT pLKO_005 462 3UTR 100% 10.800 7.560 N HCG9 n/a
3 TRCN0000250126 TGCAGAGAACATGAGCTTCTA pLKO_005 421 3UTR 100% 4.950 3.465 N HCG9 n/a
4 TRCN0000250128 CATGAGCTTCTACCTCCAGAT pLKO_005 430 3UTR 100% 4.050 2.835 N HCG9 n/a
5 TRCN0000250129 GCGAGGTCAAGCTGCAGAGAA pLKO_005 409 3UTR 100% 1.650 1.155 N HCG9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.