Transcript: Mouse NR_033745.1

Mus musculus mitochondrial inner membrane organizing system 1 (Minos1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Minos1 (433771)
Length:
2624
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033745.1
NBCI Gene record:
Minos1 (433771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347129 GAAATTGTAAGGAGGTCTTAA pLKO_005 590 3UTR 100% 13.200 9.240 N Minos1 n/a
2 TRCN0000347132 AGAGAAGAATGTGGCCATTAG pLKO_005 296 3UTR 100% 10.800 7.560 N Minos1 n/a
3 TRCN0000347130 ATGACTTTCAGGCTCCGTATC pLKO_005 365 3UTR 100% 6.000 4.200 N Minos1 n/a
4 TRCN0000363885 TTTGGTTCTGGCGTGGGATTG pLKO_005 319 3UTR 100% 6.000 4.200 N Minos1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.