Transcript: Mouse NR_045438.1

Mus musculus motile sperm domain containing 4 (Mospd4), non-coding RNA.

Source:
NCBI, updated 2016-07-26
Taxon:
Mus musculus (mouse)
Gene:
Mospd4 (72076)
Length:
883
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045438.1
NBCI Gene record:
Mospd4 (72076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341199 GTTGCTCACGGCGCATCTTAA pLKO_005 119 3UTR 100% 13.200 18.480 N Mospd4 n/a
2 TRCN0000341198 CGCCGACAGAAAGTGACAAAC pLKO_005 421 3UTR 100% 10.800 8.640 N Mospd4 n/a
3 TRCN0000341197 TGTTTGCTCCTCCGGACATTT pLKO_005 325 3UTR 100% 13.200 9.240 N Mospd4 n/a
4 TRCN0000341257 TTCTTTATCCATCATCTATTG pLKO_005 671 3UTR 100% 10.800 7.560 N Mospd4 n/a
5 TRCN0000341259 TGGATTCTTTCTAGGGAAATT pLKO_005 572 3UTR 100% 13.200 6.600 Y Mospd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.