Transcript: Human NR_052013.3

Homo sapiens NBAS subunit of NRZ tethering complex (NBAS), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NBAS (51594)
Length:
7082
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_052013.3
NBCI Gene record:
NBAS (51594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_052013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282430 GCAATTCGAGATCGTTTATTA pLKO_005 193 3UTR 100% 15.000 21.000 N NBAS n/a
2 TRCN0000262808 TGGAATCAACACAGCTATTTA pLKO_005 741 3UTR 100% 15.000 21.000 N NBAS n/a
3 TRCN0000262809 CTTGGGATGGAGCGGAATATT pLKO_005 2635 3UTR 100% 15.000 12.000 N NBAS n/a
4 TRCN0000262807 GATGACTAGAAAGGCTATTAA pLKO_005 5778 3UTR 100% 15.000 12.000 N NBAS n/a
5 TRCN0000262806 GTGTGGCTAATGAGCTATTAA pLKO_005 2873 3UTR 100% 15.000 10.500 N NBAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_052013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.