Transcript: Mouse NR_073167.1

Mus musculus nucleolar protein 8 (Nol8), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Nol8 (70930)
Length:
4836
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073167.1
NBCI Gene record:
Nol8 (70930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254168 GCATAGTGCCCTGGCAAATTT pLKO_005 3086 3UTR 100% 15.000 21.000 N Nol8 n/a
2 TRCN0000265493 AGTGGTATGGGAGGTAGTATT pLKO_005 4134 3UTR 100% 13.200 9.240 N Nol8 n/a
3 TRCN0000254166 GTATCATTCTGATGACTATTT pLKO_005 4381 3UTR 100% 13.200 9.240 N Nol8 n/a
4 TRCN0000254167 TTCTCACTTTCTGATAGTAAT pLKO_005 2961 3UTR 100% 13.200 9.240 N Nol8 n/a
5 TRCN0000254169 TTGAGAACCAGAACCATAAAG pLKO_005 2692 3UTR 100% 13.200 9.240 N Nol8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.