Transcript: Mouse NR_104376.1

Mus musculus FYN binding protein 2 (Fyb2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Fyb2 (242594)
Length:
3175
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104376.1
NBCI Gene record:
Fyb2 (242594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352498 ACCACCACCTGAGCCATAATC pLKO_005 2851 3UTR 100% 13.200 9.240 N Fyb2 n/a
2 TRCN0000341621 CTGTAGCGTGTGCCAGTAATT pLKO_005 2283 3UTR 100% 13.200 9.240 N Fyb2 n/a
3 TRCN0000341554 GCCATTGGATGTGACTAAATC pLKO_005 565 3UTR 100% 13.200 9.240 N Fyb2 n/a
4 TRCN0000352574 ACCTAGTGATCTGTCGCAATT pLKO_005 2376 3UTR 100% 10.800 7.560 N Fyb2 n/a
5 TRCN0000341553 GAACGATTTCAGTATGGTAAA pLKO_005 2240 3UTR 100% 10.800 7.560 N Fyb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.