Transcript: Human NR_111984.2

Homo sapiens arylacetamide deacetylase like 3 (AADACL3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
AADACL3 (126767)
Length:
3838
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111984.2
NBCI Gene record:
AADACL3 (126767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262891 CCGCAAGTTACCTAAGCATAA pLKO_005 303 3UTR 100% 10.800 15.120 N AADACL3 n/a
2 TRCN0000262895 TAATTGAAGGGTAGGGTAAAT pLKO_005 2405 3UTR 100% 13.200 10.560 N AADACL3 n/a
3 TRCN0000262894 ATGATGCTCTCCGGGACAATT pLKO_005 887 3UTR 100% 13.200 9.240 N AADACL3 n/a
4 TRCN0000262893 ATCATGAAAGGTGCCCATTTG pLKO_005 649 3UTR 100% 10.800 7.560 N AADACL3 n/a
5 TRCN0000262892 CTGAGTGCATTAGTTCAATTT pLKO_005 1039 3UTR 100% 13.200 7.920 N AADACL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.