Transcript: Human NR_135774.2

Homo sapiens exocyst complex component 6B (EXOC6B), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
EXOC6B (23233)
Length:
5588
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135774.2
NBCI Gene record:
EXOC6B (23233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247575 TACAACCCAGGGCTTAGTAAA pLKO_005 1200 3UTR 100% 13.200 18.480 N EXOC6B n/a
2 TRCN0000247574 GAGGGAAAGGAACTGGTAATA pLKO_005 439 3UTR 100% 13.200 9.240 N EXOC6B n/a
3 TRCN0000247578 TTGATGACATGATTCGGAAAT pLKO_005 1688 3UTR 100% 10.800 7.560 N EXOC6B n/a
4 TRCN0000247576 AGGGCTTTGTGGACTCTATAA pLKO_005 341 3UTR 100% 13.200 7.920 N EXOC6B n/a
5 TRCN0000238562 AGGGCTTTGTGGACTCTATTA pLKO_005 341 3UTR 100% 13.200 7.920 N Exoc6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.