Transcript: Human NR_146216.2

Homo sapiens PWWP domain containing 2A (PWWP2A), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PWWP2A (114825)
Length:
4123
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146216.2
NBCI Gene record:
PWWP2A (114825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265448 GGCAAGTTCTGTGTGATAAAT pLKO_005 1015 3UTR 100% 15.000 21.000 N PWWP2A n/a
2 TRCN0000253888 GACACATATAACCAATCAATA pLKO_005 900 3UTR 100% 13.200 10.560 N PWWP2A n/a
3 TRCN0000253886 CAGCAGAGGCAGAGTAGTAAA pLKO_005 1241 3UTR 100% 13.200 9.240 N PWWP2A n/a
4 TRCN0000253887 TGGTATCCCTGTGACAGTATT pLKO_005 659 3UTR 100% 13.200 9.240 N PWWP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.