Transcript: Human NR_160301.1

Homo sapiens aldo-keto reductase family 1 member B15 (AKR1B15), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-05-08
Taxon:
Homo sapiens (human)
Gene:
AKR1B15 (441282)
Length:
2319
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160301.1
NBCI Gene record:
AKR1B15 (441282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243643 GAGGTCTCTTCTCGGCAAAGT pLKO_005 1086 3UTR 100% 4.950 6.930 N AKR1B15 n/a
2 TRCN0000243645 GTGCCTATTTCTATGAGAATC pLKO_005 1157 3UTR 100% 10.800 7.560 N AKR1B15 n/a
3 TRCN0000243644 ATGAGAATCAACATGAGGTGG pLKO_005 1169 3UTR 100% 2.160 1.512 N AKR1B15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.