Transcript: Human NR_160511.1

Homo sapiens caspase recruitment domain family member 19 (CARD19), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-01-11
Taxon:
Homo sapiens (human)
Gene:
CARD19 (84270)
Length:
2406
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160511.1
NBCI Gene record:
CARD19 (84270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283811 TCGGTTTCTCGCCTGTCATCA pLKO_005 2148 3UTR 100% 4.950 6.930 N CARD19 n/a
2 TRCN0000268823 GTTCTACCGAGCCCTGTATAT pLKO_005 479 3UTR 100% 13.200 9.240 N CARD19 n/a
3 TRCN0000241110 ATCCTCCAGCTGAACCGTTAC pLKO_005 223 3UTR 100% 6.000 4.200 N Card19 n/a
4 TRCN0000268842 ATCCTCCAGCTGAACCGTTAC pLKO_005 223 3UTR 100% 6.000 4.200 N CARD19 n/a
5 TRCN0000268824 CACCTGCCACTCAACCAAAGA pLKO_005 2252 3UTR 100% 4.950 3.465 N CARD19 n/a
6 TRCN0000283812 TTACCAACAAGGAGGCGGAAA pLKO_005 257 3UTR 100% 4.050 2.835 N CARD19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.