Transcript: Mouse NR_160909.1

Mus musculus cation channel sperm associated auxiliary subunit epsilon 2 (Catspere2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Mus musculus (mouse)
Gene:
Catspere2 (545391)
Length:
3490
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160909.1
NBCI Gene record:
Catspere2 (545391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_160909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270440 TAGTACCAGGAGTTCTATTAA pLKO_005 221 3UTR 100% 15.000 7.500 Y Catspere2 n/a
2 TRCN0000347628 TCACAGTTGTAGACGTTTATT pLKO_005 436 3UTR 100% 15.000 7.500 Y Catspere2 n/a
3 TRCN0000347571 ATAGCCAAGACTATTCCATTT pLKO_005 199 3UTR 100% 10.800 5.400 Y Catspere2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.