Transcript: Human XR_002957252.1

PREDICTED: Homo sapiens RELA divergent transcript (RELA-DT), transcript variant X2, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RELA-DT (105369347)
Length:
2659
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957252.1
NBCI Gene record:
RELA-DT (105369347)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048573 CCAGCTTACGATACAGCCAAA pLKO.1 286 3UTR 100% 4.050 2.835 N LOC440046 n/a
2 TRCN0000048577 TCAAGAGCTTTGCGGAGCCTA pLKO.1 192 3UTR 100% 2.640 1.848 N LOC440046 n/a
3 TRCN0000048575 CTCCAGCTAAAGCGCCAGCTT pLKO.1 272 3UTR 100% 0.880 0.616 N LOC440046 n/a
4 TRCN0000048576 CGTCTCTGAAGCCTGGCGCTT pLKO.1 365 3UTR 100% 0.000 0.000 N LOC440046 n/a
5 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2207 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 7.9% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 7.9% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 7.9% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 7% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 7% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 7% V5 (many diffs) n/a
7 ccsbBroadEn_15487 pDONR223 0% 6% None (many diffs) n/a
8 ccsbBroad304_15487 pLX_304 0% 6% V5 (many diffs) n/a
9 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 6% V5 (many diffs) n/a
10 ccsbBroadEn_10261 pDONR223 100% 2.3% None (many diffs) n/a
11 ccsbBroad304_10261 pLX_304 0% 2.3% V5 (many diffs) n/a
12 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV