Transcript: Mouse XM_003085259.2

PREDICTED: Mus musculus adhesion G protein-coupled receptor G4 (Adgrg4), partial mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrg4 (236798)
Length:
9171
CDS:
1..9171

Additional Resources:

NCBI RefSeq record:
XM_003085259.2
NBCI Gene record:
Adgrg4 (236798)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_003085259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226086 GCAGTAAATGAACGGATATTA pLKO_005 8008 CDS 100% 15.000 21.000 N Adgrg4 n/a
2 TRCN0000226083 GAGTACACATCTAACCATAAT pLKO_005 1632 CDS 100% 13.200 18.480 N Adgrg4 n/a
3 TRCN0000244571 TGGATAAATGTTAGGCATAAA pLKO_005 8839 CDS 100% 13.200 18.480 N Adgrg4 n/a
4 TRCN0000218300 TCTAAACTCACCACCTTATTA pLKO_005 2158 CDS 100% 15.000 12.000 N Adgrg4 n/a
5 TRCN0000226084 TTGTCCTCAAGCACCATAATA pLKO_005 3907 CDS 100% 15.000 12.000 N Adgrg4 n/a
6 TRCN0000226085 GACTCTCGGGCATCCATATTT pLKO_005 5857 CDS 100% 15.000 10.500 N Adgrg4 n/a
7 TRCN0000244567 CATTGCAAGGGTTCCTCATTT pLKO_005 8726 CDS 100% 13.200 9.240 N Adgrg4 n/a
8 TRCN0000244570 CAACAACTTTCAAATCTATAG pLKO_005 8918 CDS 100% 10.800 7.560 N Adgrg4 n/a
9 TRCN0000244568 CTCAAAGGCACAATCAGTTTG pLKO_005 8614 CDS 100% 10.800 7.560 N Adgrg4 n/a
10 TRCN0000244569 CTCAGAAACAAAGATCATTTC pLKO_005 9083 CDS 100% 10.800 7.560 N Adgrg4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003085259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.