Transcript: Human XM_005259191.3

PREDICTED: Homo sapiens coiled-coil domain containing 61 (CCDC61), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC61 (729440)
Length:
3928
CDS:
2137..3699

Additional Resources:

NCBI RefSeq record:
XM_005259191.3
NBCI Gene record:
CCDC61 (729440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263236 CGACTGGACATGCGGTCATAA pLKO_005 3679 CDS 100% 13.200 9.240 N CCDC61 n/a
2 TRCN0000263237 GTTCAACATCTTCTGTCATAT pLKO_005 2349 CDS 100% 13.200 9.240 N CCDC61 n/a
3 TRCN0000263235 TGCTGGCTTCATTGAAGATTT pLKO_005 2301 CDS 100% 13.200 9.240 N CCDC61 n/a
4 TRCN0000263238 TCATCTACTCCGTGGAGTTTG pLKO_005 2525 CDS 100% 10.800 7.560 N CCDC61 n/a
5 TRCN0000263239 CCCACTTGCTGGGTATGGTGT pLKO_005 3733 3UTR 100% 0.880 0.616 N CCDC61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.