Transcript: Human XM_005263158.2

PREDICTED: Homo sapiens folliculin interacting protein 2 (FNIP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FNIP2 (57600)
Length:
5235
CDS:
19..3453

Additional Resources:

NCBI RefSeq record:
XM_005263158.2
NBCI Gene record:
FNIP2 (57600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256305 CCACAACTGATGATTAGTAAA pLKO_005 508 CDS 100% 13.200 18.480 N FNIP2 n/a
2 TRCN0000256306 CCGTTTCTCATTACGTGTAAA pLKO_005 5172 3UTR 100% 13.200 10.560 N FNIP2 n/a
3 TRCN0000265772 CCTTACTGACTGCGGTGTTAA pLKO_005 1415 CDS 100% 13.200 10.560 N FNIP2 n/a
4 TRCN0000265784 AGTAGAGACCTGGGTCTTAAA pLKO_005 1927 CDS 100% 13.200 9.240 N FNIP2 n/a
5 TRCN0000256307 TAAATGGGAGCAAGATCATAA pLKO_005 1751 CDS 100% 13.200 9.240 N FNIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.