Transcript: Human XM_005267860.4

PREDICTED: Homo sapiens YLP motif containing 1 (YLPM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YLPM1 (56252)
Length:
7398
CDS:
175..6360

Additional Resources:

NCBI RefSeq record:
XM_005267860.4
NBCI Gene record:
YLPM1 (56252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247697 ACGGGATAAAGGTCTAGTAAA pLKO_005 3267 CDS 100% 13.200 10.560 N YLPM1 n/a
2 TRCN0000247698 CAACAGTATCAGCAGATTATA pLKO_005 1423 CDS 100% 15.000 10.500 N YLPM1 n/a
3 TRCN0000247694 CCGAGATATATCCACTAATAA pLKO_005 5109 CDS 100% 15.000 10.500 N YLPM1 n/a
4 TRCN0000247696 TATGGGCTCTGGGATACAAAT pLKO_005 4912 CDS 100% 13.200 9.240 N YLPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.