Transcript: Mouse XM_006495916.3

PREDICTED: Mus musculus dynein, axonemal, heavy chain 7B (Dnah7b), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnah7b (227058)
Length:
12505
CDS:
544..12393

Additional Resources:

NCBI RefSeq record:
XM_006495916.3
NBCI Gene record:
Dnah7b (227058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342160 AGTGATGTGGATGGGTAAATC pLKO_005 11817 CDS 100% 13.200 9.240 N Dnah7b n/a
2 TRCN0000342212 CACAACCGCCAGGATTCATTA pLKO_005 1444 CDS 100% 13.200 9.240 N Dnah7b n/a
3 TRCN0000342162 CTGTACCAAATCGATGATAAA pLKO_005 832 CDS 100% 13.200 9.240 N Dnah7b n/a
4 TRCN0000342214 CAGGGAATTTATGCGCTTAAA pLKO_005 10350 CDS 100% 13.200 6.600 Y Dnah7b n/a
5 TRCN0000342211 GGCTATCGGATCATCGCTATT pLKO_005 9922 CDS 100% 10.800 5.400 Y Dnah7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.