Transcript: Mouse XM_006496788.3

PREDICTED: Mus musculus predicted gene 4846 (Gm4846), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4846 (226601)
Length:
2743
CDS:
54..1670

Additional Resources:

NCBI RefSeq record:
XM_006496788.3
NBCI Gene record:
Gm4846 (226601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496788.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367226 CGCACTCTTCACCCGTTATAA pLKO_005 755 CDS 100% 15.000 21.000 N Gm4846 n/a
2 TRCN0000367224 GGAACCGAGTTTGGGATAATG pLKO_005 718 CDS 100% 13.200 9.240 N Gm4846 n/a
3 TRCN0000367292 GGTTTAACCATGCCAATTATG pLKO_005 844 CDS 100% 13.200 7.920 N Gm4846 n/a
4 TRCN0000367294 ACCTGCCAAATCGCATCATTT pLKO_005 916 CDS 100% 13.200 6.600 Y Gm4846 n/a
5 TRCN0000367024 ACCTGCCAAATCGCATCATTA pLKO_005 916 CDS 100% 13.200 6.600 Y Gm4847 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496788.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.