Transcript: Mouse XM_006497207.2

PREDICTED: Mus musculus spermatogenesis associated 17 (Spata17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata17 (74717)
Length:
5115
CDS:
173..1312

Additional Resources:

NCBI RefSeq record:
XM_006497207.2
NBCI Gene record:
Spata17 (74717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246762 AGTCTTGGAACAGCGTTATAA pLKO_005 970 CDS 100% 15.000 21.000 N Spata17 n/a
2 TRCN0000246765 GGCTTTAGGATCCGGAAATAT pLKO_005 530 CDS 100% 15.000 12.000 N Spata17 n/a
3 TRCN0000246766 GTTGTTGAGGCAGCATATTAT pLKO_005 452 CDS 100% 15.000 10.500 N Spata17 n/a
4 TRCN0000246764 CAAAGCAGATTTCAGGTATAT pLKO_005 732 CDS 100% 13.200 9.240 N Spata17 n/a
5 TRCN0000246763 TTTGGAGGAGTTCGCAGAAAT pLKO_005 622 CDS 100% 13.200 9.240 N Spata17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.