Transcript: Mouse XM_006498799.2

PREDICTED: Mus musculus centrosomal protein 250 (Cep250), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep250 (16328)
Length:
7674
CDS:
75..7205

Additional Resources:

NCBI RefSeq record:
XM_006498799.2
NBCI Gene record:
Cep250 (16328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252439 CGGTCGTCTTCTCAATCTATG pLKO_005 416 CDS 100% 10.800 15.120 N Cep250 n/a
2 TRCN0000252438 GATGGAAAGAGCCCGAGTAAA pLKO_005 5070 CDS 100% 13.200 10.560 N Cep250 n/a
3 TRCN0000258228 AGTTTGCCAAAGGCGAGATTT pLKO_005 7305 3UTR 100% 13.200 9.240 N Cep250 n/a
4 TRCN0000252436 CAACTGGAGAGCAATCTATTT pLKO_005 2265 CDS 100% 13.200 9.240 N Cep250 n/a
5 TRCN0000252437 GAGTTCTTCAAGGGCTATTTG pLKO_005 384 CDS 100% 13.200 9.240 N Cep250 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.