Transcript: Mouse XM_006501550.3

PREDICTED: Mus musculus SH3 domain protein D19 (Sh3d19), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sh3d19 (27059)
Length:
5535
CDS:
880..3252

Additional Resources:

NCBI RefSeq record:
XM_006501550.3
NBCI Gene record:
Sh3d19 (27059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247110 CCCATCGACACACCGAATTAA pLKO_005 3582 3UTR 100% 15.000 21.000 N Sh3d19 n/a
2 TRCN0000247109 GTCGCACGGTTTGAGTATATT pLKO_005 2608 CDS 100% 15.000 21.000 N Sh3d19 n/a
3 TRCN0000247107 CCCAAGAAACCCGAGATTATT pLKO_005 976 CDS 100% 15.000 10.500 N Sh3d19 n/a
4 TRCN0000247108 TCAAGGCTGGAGACGTAATAA pLKO_005 3131 CDS 100% 15.000 10.500 N Sh3d19 n/a
5 TRCN0000247106 TGCATCCAAATCATCAAATAA pLKO_005 1938 CDS 100% 15.000 10.500 N Sh3d19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.