Transcript: Mouse XM_006502044.1

PREDICTED: Mus musculus sucrase isomaltase (alpha-glucosidase) (Sis), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sis (69983)
Length:
5957
CDS:
65..5521

Additional Resources:

NCBI RefSeq record:
XM_006502044.1
NBCI Gene record:
Sis (69983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269149 GGTGTACTCAAACCAATATTT pLKO_005 694 CDS 100% 15.000 21.000 N Sis n/a
2 TRCN0000269147 TATGGATTCCATCCGTATTAC pLKO_005 3476 CDS 100% 13.200 18.480 N Sis n/a
3 TRCN0000269148 TCGAACCACAATCCCTATTTG pLKO_005 2969 CDS 100% 13.200 10.560 N Sis n/a
4 TRCN0000428087 ACATCTTAGAGGAGGTTATAT pLKO_005 2401 CDS 100% 15.000 10.500 N SI n/a
5 TRCN0000269095 TCACACTCCTTATCTAATATT pLKO_005 5614 3UTR 100% 15.000 10.500 N Sis n/a
6 TRCN0000269097 GATCAACCTCCTGGATATAAA pLKO_005 3446 CDS 100% 15.000 9.000 N Sis n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502044.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.