Transcript: Mouse XM_006502263.2

PREDICTED: Mus musculus TSSK6 activating co-chaperone (Tsacc), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsacc (76927)
Length:
599
CDS:
210..584

Additional Resources:

NCBI RefSeq record:
XM_006502263.2
NBCI Gene record:
Tsacc (76927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281673 GGAAGATAGCGTTGCGTGTTT pLKO_005 254 CDS 100% 4.950 6.930 N Tsacc n/a
2 TRCN0000267903 CGAGTGCATGTATGCCAACCT pLKO_005 404 CDS 100% 2.640 3.696 N Tsacc n/a
3 TRCN0000267960 CATTGATCTTCCAGCAAATTT pLKO_005 302 CDS 100% 15.000 10.500 N Tsacc n/a
4 TRCN0000283561 TTCTTGACCATCCAGACAAAG pLKO_005 336 CDS 100% 10.800 7.560 N Tsacc n/a
5 TRCN0000281680 GTCTTCAGGAGCTGGTCAGAA pLKO_005 359 CDS 100% 4.950 3.465 N Tsacc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.