Transcript: Mouse XM_006502298.3

PREDICTED: Mus musculus nucleoporin 210-like (Nup210l), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nup210l (77595)
Length:
4979
CDS:
205..4845

Additional Resources:

NCBI RefSeq record:
XM_006502298.3
NBCI Gene record:
Nup210l (77595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346610 CTAGCAGTGTCTGGCTATAAG pLKO_005 4384 CDS 100% 13.200 10.560 N Nup210l n/a
2 TRCN0000346609 CCTCGATCTCAACTCGGATAA pLKO_005 957 CDS 100% 10.800 8.640 N Nup210l n/a
3 TRCN0000346530 AGATCCAGATCCTGGTATTTG pLKO_005 3029 CDS 100% 13.200 9.240 N Nup210l n/a
4 TRCN0000346607 CAACGAGACACTAGCTCATTT pLKO_005 1656 CDS 100% 13.200 9.240 N Nup210l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.