Transcript: Mouse XM_006503252.3

PREDICTED: Mus musculus DMRT-like family B with proline-rich C-terminal, 1 (Dmrtb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmrtb1 (56296)
Length:
2002
CDS:
92..1285

Additional Resources:

NCBI RefSeq record:
XM_006503252.3
NBCI Gene record:
Dmrtb1 (56296)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238616 TCAAGGGCCATACGGGCAAAT pLKO_005 147 CDS 100% 10.800 15.120 N Dmrtb1 n/a
2 TRCN0000238620 CTACCAGTCCTTTCCACTTTC pLKO_005 886 CDS 100% 10.800 8.640 N Dmrtb1 n/a
3 TRCN0000238618 TTCACCATGTTCATGTTATAT pLKO_005 1346 3UTR 100% 15.000 10.500 N Dmrtb1 n/a
4 TRCN0000238619 CCACCATCTCCACCATCTTTC pLKO_005 1166 CDS 100% 10.800 6.480 N Dmrtb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.