Transcript: Mouse XM_006506102.2

PREDICTED: Mus musculus glutamate receptor interacting protein 2 (Grip2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grip2 (243547)
Length:
5122
CDS:
69..3182

Additional Resources:

NCBI RefSeq record:
XM_006506102.2
NBCI Gene record:
Grip2 (243547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341901 CAGATGCTCTGAGGTCATTAT pLKO_005 3171 CDS 100% 13.200 10.560 N Grip2 n/a
2 TRCN0000341830 CCACCCTTGGTGCGATTTATT pLKO_005 1509 CDS 100% 15.000 10.500 N Grip2 n/a
3 TRCN0000341831 AGGTTGGCCATACAATCATTT pLKO_005 3665 3UTR 100% 13.200 9.240 N Grip2 n/a
4 TRCN0000341903 AGCTGCAAGGAGGCATCTTTG pLKO_005 1468 CDS 100% 10.800 7.560 N Grip2 n/a
5 TRCN0000341829 ATGTTCGCACTCGGGACTTTG pLKO_005 3031 CDS 100% 10.800 7.560 N Grip2 n/a
6 TRCN0000360059 TCATCTCCGACATCAAGAAAG pLKO_005 1810 CDS 100% 10.800 7.560 N GRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506102.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.