Transcript: Mouse XM_006509749.4

PREDICTED: Mus musculus cytochrome P450, family 4, subfamily f, polypeptide 18 (Cyp4f18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cyp4f18 (72054)
Length:
2706
CDS:
1465..2628

Additional Resources:

NCBI RefSeq record:
XM_006509749.4
NBCI Gene record:
Cyp4f18 (72054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247298 CTCCTGCCTTCTGGCTTACAT pLKO_005 126 5UTR 100% 5.625 3.938 N Cyp4f18 n/a
2 TRCN0000247299 CCCAAACGAAACTGGATCTTG pLKO_005 208 5UTR 100% 4.950 3.465 N Cyp4f18 n/a
3 TRCN0000247297 CTCTCCATGGCTGTTGCTGTT pLKO_005 93 5UTR 100% 4.050 2.835 N Cyp4f18 n/a
4 TRCN0000257661 TCTCTTCGCCTCCGCTGTTTC pLKO_005 178 5UTR 100% 3.600 2.520 N Cyp4f18 n/a
5 TRCN0000433806 CCAAGACTTTGGACTTCATTG pLKO_005 1931 CDS 100% 10.800 5.400 Y CYP4F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.