Transcript: Mouse XM_006509862.3

PREDICTED: Mus musculus centrosomal protein 126 (Cep126), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep126 (234915)
Length:
5097
CDS:
274..3645

Additional Resources:

NCBI RefSeq record:
XM_006509862.3
NBCI Gene record:
Cep126 (234915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252679 ACGCAGAATTAACCGTAATAA pLKO_005 831 CDS 100% 15.000 12.000 N Cep126 n/a
2 TRCN0000252680 CACCGAGCAAATAACTCATTT pLKO_005 3171 CDS 100% 13.200 10.560 N Cep126 n/a
3 TRCN0000252677 CTACTTAGTGGAATCATTATT pLKO_005 4690 3UTR 100% 15.000 10.500 N Cep126 n/a
4 TRCN0000252678 ACTCCTAGAGGATCAACATTT pLKO_005 930 CDS 100% 13.200 9.240 N Cep126 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.