Transcript: Mouse XM_006514589.3

PREDICTED: Mus musculus NAC alpha domain containing (Nacad), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nacad (192950)
Length:
3695
CDS:
302..3601

Additional Resources:

NCBI RefSeq record:
XM_006514589.3
NBCI Gene record:
Nacad (192950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253112 CAAGACCCACTCACCTCAAAG pLKO_005 3283 CDS 100% 10.800 8.640 N Nacad n/a
2 TRCN0000226095 GCTATGGCCGTGGCTACATAT pLKO_005 2450 CDS 100% 13.200 9.240 N Nacad n/a
3 TRCN0000226097 AGCGTGGTAGAGGCACCAAAT pLKO_005 3327 CDS 100% 10.800 7.560 N Nacad n/a
4 TRCN0000218144 ATCATCTCTAACCCTACAAAG pLKO_005 2644 CDS 100% 10.800 7.560 N Nacad n/a
5 TRCN0000253111 CACTCATGTGATGCAGCTATT pLKO_005 575 CDS 100% 10.800 7.560 N Nacad n/a
6 TRCN0000226096 CCAGTAGCATCACCTTCATTG pLKO_005 2756 CDS 100% 10.800 7.560 N Nacad n/a
7 TRCN0000253109 CCTGGTTGTAGAACAAGTATC pLKO_005 2023 CDS 100% 10.800 7.560 N Nacad n/a
8 TRCN0000253108 GTCAACCTCAGACCTAGAATC pLKO_005 2791 CDS 100% 10.800 7.560 N Nacad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.