Transcript: Mouse XM_006514904.3

PREDICTED: Mus musculus Sfi1 homolog, spindle assembly associated (yeast) (Sfi1), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfi1 (78887)
Length:
3591
CDS:
600..3323

Additional Resources:

NCBI RefSeq record:
XM_006514904.3
NBCI Gene record:
Sfi1 (78887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247870 GTTACTTCAGTGCAGATATAT pLKO_005 2706 CDS 100% 15.000 7.500 Y Sfi1 n/a
2 TRCN0000247869 ACATTAGAGAAGCAAGTATTT pLKO_005 2076 CDS 100% 13.200 6.600 Y Sfi1 n/a
3 TRCN0000272401 ACATTAGAGAAGCAAGTATTT pLKO_005 2076 CDS 100% 13.200 6.600 Y SFI1 n/a
4 TRCN0000247871 CTGGAAGTCCTGGTTGATATA pLKO_005 1097 CDS 100% 13.200 6.600 Y Sfi1 n/a
5 TRCN0000247872 GGCCAGAGCAGATGGTCATTT pLKO_005 1949 CDS 100% 13.200 6.600 Y Sfi1 n/a
6 TRCN0000247868 ATGAGGAAGAGGTTCCGAATA pLKO_005 1038 CDS 100% 10.800 5.400 Y Sfi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.