Transcript: Mouse XM_006516934.2

PREDICTED: Mus musculus predicted gene 906 (Gm906), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm906 (380882)
Length:
6253
CDS:
3181..6213

Additional Resources:

NCBI RefSeq record:
XM_006516934.2
NBCI Gene record:
Gm906 (380882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267331 AGAGCCTGTGACCCATATATG pLKO_005 6010 CDS 100% 13.200 6.600 Y Gm906 n/a
2 TRCN0000267332 TCGGAAGAACACCTTACTTAA pLKO_005 5601 CDS 100% 13.200 6.600 Y Gm906 n/a
3 TRCN0000267329 TGGGAAACATGGACCATATTC pLKO_005 3864 CDS 100% 13.200 6.600 Y Gm906 n/a
4 TRCN0000267892 ACCATCACAACCTATGGAAAT pLKO_005 3459 CDS 100% 10.800 5.400 Y Gm904 n/a
5 TRCN0000267330 CATTGGTAAGCATATCGATAT pLKO_005 5082 CDS 100% 10.800 5.400 Y Gm906 n/a
6 TRCN0000283559 GCAACAGCTCCATGGACATAG pLKO_005 3230 CDS 100% 10.800 5.400 Y Gm904 n/a
7 TRCN0000267333 TCCTAGCTGATAAGATCAAAG pLKO_005 5405 CDS 100% 10.800 5.400 Y Gm906 n/a
8 TRCN0000267904 TGGACATGACCATTGGCTTTA pLKO_005 3254 CDS 100% 10.800 5.400 Y Gm904 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.