Transcript: Mouse XM_006518003.2

PREDICTED: Mus musculus solute carrier family 4, sodium bicarbonate cotransporter, member 7 (Slc4a7), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc4a7 (218756)
Length:
7257
CDS:
223..3639

Additional Resources:

NCBI RefSeq record:
XM_006518003.2
NBCI Gene record:
Slc4a7 (218756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252270 TCCGTTTACAAAGACTATAAT pLKO_005 6100 3UTR 100% 15.000 12.000 N Slc4a7 n/a
2 TRCN0000252271 CCCTTGGTGGACCTTACTAAT pLKO_005 2610 CDS 100% 13.200 10.560 N Slc4a7 n/a
3 TRCN0000252273 ACCTTTCCTATCTATCATTAA pLKO_005 1943 CDS 100% 13.200 9.240 N Slc4a7 n/a
4 TRCN0000258185 TTGGTGTTCATGTACCATTTA pLKO_005 371 CDS 100% 13.200 9.240 N Slc4a7 n/a
5 TRCN0000252272 GTTCGATCCTTTGCAGATATA pLKO_005 928 CDS 100% 13.200 7.920 N Slc4a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.