Transcript: Mouse XM_006519676.3

PREDICTED: Mus musculus RIKEN cDNA 1700112E06 gene (1700112E06Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrmda (76633)
Length:
2017
CDS:
373..1092

Additional Resources:

NCBI RefSeq record:
XM_006519676.3
NBCI Gene record:
Lrmda (76633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352472 GAAACGTGGCATGTCCCAATG pLKO_005 704 CDS 100% 6.000 8.400 N Lrmda n/a
2 TRCN0000341221 CCCTCAACAAGAACCAAATTA pLKO_005 614 CDS 100% 15.000 10.500 N Lrmda n/a
3 TRCN0000341220 GAAGGATGAGGAAGACTATAA pLKO_005 741 CDS 100% 13.200 9.240 N Lrmda n/a
4 TRCN0000352473 AGCTGCCCAAGTTGAAGTTTC pLKO_005 788 CDS 100% 10.800 7.560 N Lrmda n/a
5 TRCN0000341151 CTGGAAGGACTGAGTGCATTC pLKO_005 508 CDS 100% 6.000 4.200 N Lrmda n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.