Transcript: Mouse XM_006520698.3

PREDICTED: Mus musculus TBC1 domain family, member 31 (Tbc1d31), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d31 (210544)
Length:
4021
CDS:
631..3816

Additional Resources:

NCBI RefSeq record:
XM_006520698.3
NBCI Gene record:
Tbc1d31 (210544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520698.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244609 ACTTCATAGATCGTGATATAA pLKO_005 2306 CDS 100% 15.000 21.000 N Tbc1d31 n/a
2 TRCN0000244608 TCGGTACATAGCATCCATTAT pLKO_005 1584 CDS 100% 13.200 18.480 N Tbc1d31 n/a
3 TRCN0000244610 TTGTGGCGTTAGCTGATTATT pLKO_005 929 CDS 100% 15.000 12.000 N Tbc1d31 n/a
4 TRCN0000244612 TGAATTGTCAGAAGGATTAAA pLKO_005 1842 CDS 100% 15.000 10.500 N Tbc1d31 n/a
5 TRCN0000244611 TTTACCATTAAACAATCAGAG pLKO_005 3824 3UTR 100% 4.050 2.835 N Tbc1d31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520698.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.