Transcript: Mouse XM_006520835.2

PREDICTED: Mus musculus bromodomain containing 1 (Brd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brd1 (223770)
Length:
4752
CDS:
313..3489

Additional Resources:

NCBI RefSeq record:
XM_006520835.2
NBCI Gene record:
Brd1 (223770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238577 TCCTACCCAGCACTGATTATT pLKO_005 3136 CDS 100% 15.000 21.000 N Brd1 n/a
2 TRCN0000218808 AGAATGTGTTGCGAGGTTATA pLKO_005 4209 3UTR 100% 13.200 18.480 N Brd1 n/a
3 TRCN0000238576 CGCTTGCATCGGATCAGTATT pLKO_005 451 CDS 100% 13.200 18.480 N Brd1 n/a
4 TRCN0000219017 GTGCATCTGAATCCAGTATTT pLKO_005 2861 CDS 100% 13.200 18.480 N Brd1 n/a
5 TRCN0000218234 CTAGAAGCTCAAGGGTATAAA pLKO_005 2158 CDS 100% 15.000 12.000 N Brd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.