Transcript: Mouse XM_006524127.3

PREDICTED: Mus musculus adhesion G protein-coupled receptor F5 (Adgrf5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrf5 (224792)
Length:
5977
CDS:
548..4714

Additional Resources:

NCBI RefSeq record:
XM_006524127.3
NBCI Gene record:
Adgrf5 (224792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265571 CAATAACCCGGGACCCAATTT pLKO_005 2082 CDS 100% 13.200 18.480 N Adgrf5 n/a
2 TRCN0000254585 GATCACCCGCCTTACCATTTA pLKO_005 1534 CDS 100% 13.200 18.480 N Adgrf5 n/a
3 TRCN0000218475 AGACATACTTGCTACCATTAA pLKO_005 3043 CDS 100% 13.200 10.560 N Adgrf5 n/a
4 TRCN0000217948 GCAATGTGACATTGGATATTT pLKO_005 1590 CDS 100% 15.000 10.500 N Adgrf5 n/a
5 TRCN0000254587 GCTGTGTTCCACATCATATTT pLKO_005 4406 CDS 100% 15.000 10.500 N Adgrf5 n/a
6 TRCN0000226141 CCGAGCAATGAGACGAAATTC pLKO_005 1349 CDS 100% 13.200 9.240 N Adgrf5 n/a
7 TRCN0000226142 GAACACCTCAGCTGGTATTAA pLKO_005 2173 CDS 100% 15.000 9.000 N Adgrf5 n/a
8 TRCN0000254586 CATCCAGAACAGCGACAAATA pLKO_005 1477 CDS 100% 13.200 7.920 N Adgrf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.